PROBE qPCR Master Mix | 13-10506-01

R$ 375,30
ou 2 x R$ 194,46
. Comprar  
PROBE qPCR Master Mix  (100 reações x 25uL)
Código: 13-10506-01


Armazenamento: –20°C.
Este kit é estável durante 10 dias à temperatura ambiente.

Descrição: PROBE qPCR Master Mix é um novo kit desenvolvido para ensaios de PCR quantitativos (qPCR) utilizando sondas fluorogênicas que incorporam as sondas TaqMan e que contêm a enzima HotStart Taq DNA polimerase.
A Hot Start Taq DNA polimerase é uma Taq polimerase recombinante complexada com um anticorpo monoclonal anti-Taq que bloqueia a atividade da enzima à temperatura ambiente proporcionando um "início a quente" automático nas reações de qPCR com o objetivo de aumentar a sensibilidade e a especificidade deste ensaio de detecção.
Este kit foi otimizado para aplicações de PCR em tempo real que exigem alta sensibilidade e especificidade na detecção de alvos de DNA com sondas fluorogênicas incluindo a detecção e quantificação de agentes patogênicos, organismos geneticamente modificados e análise de expressão gênica.
A sonda qPCR Master Mix é compatível com os instrumentos de PCR em tempo real, incluindo os que que não requerem o corante de referência ROX, a saber; Roche LightCycler 480, Qiagen Rotor-Gene Q / 3000/6000, Eppendorf Mastercycler ep / realplex realplex 2 s, Illumina Eco qPCR, Bio- Rad CFX96 / CFX384, BioRad iCycler iQ / Meu iQ / IQ5 e Thermo Scientific PikoReal real-Time PCR, Applied Biosystems 7500/7500 Rápido / VIIa 7 / QuantStudio 12K Flex e Stratagene Mx3000P / Mx3005P / MX4000 e Bioer.

Lista de components: Cada kit contem reagentes suficientes para realizar 100 reações com volume final de 25 mL
Cód. N° 13-10506-01 100 reações
1.25 mL 2X PROBE qPCR Master Mix 1 tubo
50 µL Hot Start Taq DNA Polymerase 1 tubo
 
  • Obs.: Amostra q.s.p 10 reações
 
Protocolo: Este protocolo é para um volume final de reação de 25 mL. No entanto, o volume da reação poderá ser ajustado conforme desejado.
Para reação múltipla, preparar uma mistura principal dos componentes comuns a todas as reações para diminuir os erros de pipetagem.
1. Descongelar os componentes à temperatura ambiente. Quando descongeladas, ressuspender o 2X PROBE qPCR Master Mix, primers e sonda com auxílio do vôrtex e, em seguida, brevemente centrífugar para recolher a solução no fundo do tubo.
A fim de maximizar a especificidade, manter todos os componentes, as misturas de reação e as amostras em gêlo.
2. Preparar a seguinte mistura de reação para cada amostra:
Componente Volume Conc. Final
2X PROBE qPCR     Master Mix or
Master Mix LOW ROX
12.5 µL 1X
Primer Forward (20 µM) 0.5 µL 0.4 µM        (0.2 – 0.8 µM)
Primer Reverse (20 µM) 0.5 µL 0.4 µM        (0.2 – 0.8 µM)
Probe (10 µM) 0.5 µL 0.2 µM      
Hot Start Taq DNA Polymerase 0.5 µL  
DNA Template < 10.5 µL  
Nuclease-free water to 25 µL  
 
Condições de amplificação sugeridas pra qPCR
2- Protocolo step cycling
Stage Step Temp Time
Hold Desnaturação inicial 95oC 2 min
40 cycles Desnaturação 95oC 15 seg
Anelamento e Extensão 60oC
(aquisição de dados)
60 seg*
 
* O tempo de extensão é dependente da aquisição dos dados e deverá ser ajustado para cada instrumento de qPCR. A etapa apropriada para a aquisição de dados fluorescentes varia para diferentes formatos de ensaios com sonda. A aquisição de dados de ensaios com sondas de 5'-nuclease (TaqMan) deve ser realizado no final da etapa de extensão.
Alguns pares de primers podem exigir um protocolo de ciclagem de 3 etapas para um desempenho ideal. A temperatura de melting e da concentração dos primers podem precisar ser definidos empiricamente para pares de primers específicos e o instrumento termociclador.
3- Protocolo step cycling
Etapa Passo Temperatura Tempo
Hold denaturação inicial 95oC 2 min
40 ciclos Denaturação 95oC 15 seg
Anelamento 50oC  – 60oC 15 seg
Extensão 72oC
(aquisição dos dados)
45 seg
 
Ensaio de otimização: O desenhos dos primers e das sondas altamente específicos é um parâmetro crítico para a qPCR bem sucedida. O uso de programas para desenho dos primers é recomendada, a fim de minimizar a formação de estruturas secundárias internas e auto-anelamento na extremidade 3 'dentro de cada primer, o par de primers, e as combinações primer/sonda.
Para melhores resultados, o tamanho do amplicom deve ser limitada a 65-200 pb. Os resultados ótimos podem requerer titulação da concentração de iniciador de entre 200 e 800 nM. A concentração final de 400 nM de cada primer e sonda de 200 nM é ideal para a maioria das aplicações.
O aumento da concentração do primer que inicia a síntese da cadeia alvo que é complementar à sonda pode melhorar o sinal de fluorescência para alguns conjuntos de primer/sonda.
Ensaio de controle da qualidade: Este kit é funcionalmente testado em ensaios de qPCR utilizando o equipamento Applied Biosystems 7500 Real-Time PCR System seguindo os procedimentos descritos neste manual (protocolo de ciclagem 2-etapas = 2 cycling) para a detecção do gene de RNase P a partir de 20 ng de DNA genômico humano como template.
RnaseP Forward Primer
5’ AGA TTT GGA CCT GCG AGC G 3'
RnaseP Reverse Primer
5’ GAG CGG CTG TCT CCA CAA GT 3'
RnaseP Probe
5'FAM TTCTGACCTGAAGGCTCTGCGCG BHQ1 3'
 
O gene de RNase P humana é um gene de cópia única que codifica a fração de RNa para a enzima RNase P.
A análise de ensaio de qPCR em tempo real deve demonstrar a detecção do gene de RNase P humano com um CT (limiar de ciclo) <30.
 


 
• Prazo para postagem:
• Código do produto: 29B097
• Quantidade mínima: 1
• Disponibilidade: produto feito sob encomenda
• Pagamento no momento do pedido: 100% de sinal
Veja também